We Care Health Services
| Contact Us | Query |
Home Infertility Fertility Surrogacy Genetic Doctors

www.ivfsurrogacy.com
 
 
We Care Health Services IVF, Surrogacy, Surrogacy Mother IVF, Surrogacy, Surrogacy Mother Genetic Treatments for Infertility IVF, Surrogacy, Surrogacy Mother Genetic Treatments for Infertility
 
 
10
Genetic Treatments for Infertility
Karyotyping
FISH
PGD
Genetic Counseling
10
 

10
About Us

10
 

10
About Us
InFertility Problem
Carrying Your Seeds
Loss Of The Fetus
Serious Genetic Disease
Choice For Egg Donation
Send a Quote
IVF Doctors In India
10
 

10
10
 

You are here : Home / Genetic
Text :    


Genetic Treatments for Infertility

Genetics

  • What is DNA?
  • What are Chromosomes?
  • Genetic Mistakes?
  • Chromosome errors?
  • How do we test DNA?


  • What is DNA?

    DNA (deoxyribose nucleic acid) is a code inside cells to tell the body what it needs to function and what to look like. The code is made up of 4 different chemical units called bases. The bases are adenine (A), thymine (T), guanine (G) and cytosine (C). The code, if you were to read it, would look something like this: ...CGTAGCTTACTTTAGGCTAGCAAACGCATC....

    A gene is a small section of the code (though much longer than this example) that can be decoded by the cell to mean something. A single gene might be responsible for any aspect of your body's function or appearance, like making a certain protein, or the colour of your eyes.

    If there is an error in the code for a gene the product will be faulty. When a cell divides, identical copies of the DNA must be made and distributed evenly into the new cells e.g. when a baby is developing or when we make new blood or skin cells. The copied DNA is packaged into chromosomes and each cell receives an identical copy of each chromosome.

    ^ Back to Top

    What are Chromosomes?

    Packaging the DNA into chromosomes ensures that the genetic material is copied and distributed evenly when a cell divides. Chromosomes can only be seen under the microscope when a cell is dividing.

    Long strings of DNA, containing hundreds of genes each, coil up in the form of chromosomes. In normal human cells there are 46 chromosomes There is one pair of sex chromosomes (two X chromosomes for females and one X and one Y chromosome for males) and 22 pairs of autosomes (non-sex chromosomes) numbered 1-22.

    When a cell divides the DNA is copied and 1 copy of each chromosome is distributed into each new cell (mitosis). The new cells are an identical copy of the previous cell. When producing sperm and eggs, the cells divide so that there are only 23 chromosomes - one of each pair (meiosis).

    At fertilization, the chromosomes from the sperm and egg come together to give a new full complement of 46 chromosomes in the embryo. Usually the DNA is copied exactly and the chromosomes are distributed perfectly, but sometimes errors are made by the cell (see Genetic Mistakes).

    ^ Back to Top

    Genetic Mistakes

    Gene errors Sometimes mistakes can happen in the copying of the code when a cell divides:

    • Gene deletion
      • A section of the DNA can be missed out
      • GTCAACTGATCGATCGGATCGA
        GTCAAC___TCGATCGGATCGA
    • Gene mutation
      • The wrong base might be copied
      • GTCAACTGATCGATCGGATCGA
        GTCAACTGCTCGATCGGATCGA
    Once these errors are made, the gene may be faulty and not function properly. It may cause a genetic disease, such as cystic fibrosis. The faulty gene will be copied exactly and can be passed down from generation to generation.

    ^ Back to Top

    Chromosome errors

    Chromosome loss or gain.

    When a cell is dividing, sometimes a whole chromosome can end up in the wrong cell, so that the cell has the wrong number of chromosomes (aneuploidy). One cell will have one too many chromosomes (chromosome gain) and one will have one too few (chromosome loss).

    If there is an extra chromosome, the cells have extra DNA and if there is one missing there will be less. This is rather like having either too many or not enough ingredients for a recipe.

    These mistakes can happen when any cell is dividing but if they occur during the formation of sperm and egg cells, it will affect the genetic makeup of the embryo.

    You may be familiar with Down syndrome that is caused by having an extra copy of chromosome 21. This gives 3 copies in total and Down syndrome is sometimes called trisomy 21

    ^ Back to Top

    Chromosome rearrangement

    Pieces of chromosomes can sometimes be rearranged, so that one piece of a chromosome is stuck on another (translocation) A handy way to think about this is if you imagine that you have two complete sets of Encyclopaedia Britannica in your house, stored in a very orderly fashion.

    If, for some reason, the order of the two sets of books is rearranged, it doesn't bother you, because you still have 2 copies of all the volumes.

    But if you then swapped a set of the books with someone else, not realising that their order had been changed, you might find yourself with two copies of volume 6, but none of volume 11! This is very irritating if you need to know something in Volume 11. Imagine if the information in that book was crucial for your survival, as is almost always the case with chromosomes.

    If you have a translocation it would not affect you, because you would still have all the information you need, just in a different order.

    But then, when you produce sperm or eggs, which only have half the number of chromosomes as the rest of your cells, the matching chromosome pieces could get separated during the cell divisions. You could end up with the right combination if the sperm or egg receives one of each pair with the rearrangement or one of each pair not rearranged.

    You could end up with the wrong combination if the sperm or egg receives one of the pair with the rearrangement and one of the pair not rearranged.

    Then the egg or sperm wouldn't have all the information it needs. The wrong dose of chromosomes will usually result in failed implantation, miscarriage, or an abnormality in the baby.

    ^ Back to Top

    How do we test DNA

    The available techniques to test DNA are:

    • Karyotyping - Click to Know More
    • FISH - Click to Know More
    • PGD - Click to Know More




    ^ Back to Top

    For more information, medical assessment and medical quote
    send your detailed medical history and medical reports
    as email attachment to
    Em@il : - info@wecareindia.com
    Call: +91 9029304141 (10 am. To 8 pm. IST)
    (Only for international patients seeking treatment in India)
    You are here : Home / Genetic
         
    sideBar
    Send Response
     
             
             
             
      
    Go Back Print This Page
    Success
    Other Procedures
    India
    Know More
    For Professionals
    Resources
    Success Rates
    Success Rates By Age
    Happy Families
    Pre Treatment Investigation
    Laparoscopy Procedures
    Cord Blood Banking
    About India
    Medical Tourism
    Medical Visa
    Stay in India
    FAQ's
    Facilities
    Fully Inclusive Prices
    IVF Centres
    Be Our Associate
    Corporates
    Insurance
    Refer a Patient
    Affiliations
    IVF News
    Links
    Blogs
    Useful Info
    Glossary
    Related Links

    Home   |   About Us   |   Site Map   |   Get a Quote  |   Disclaimer   |  Advertise With Us   |   Contact Us
    Copyright © 2009-2010 We Care India. All Rights Reserved.
    Registered Office Mumbai : - 103, Gaurav Philips, Near Rishi Complex, Holy Cross Road, IC Colony, Borivali (West) Mumbai - 400103 Phone Number : +91 9029304141
    Registered Office Delhi : - IB/5B, Phase - 1, Ashok Vihar, Delhi - 110052, India.
    Valid HTML 4.01 Transitional Valid CSS! Digg Me !

    Genetic Infertility Treatment Cost, Genetic Infertility Treatment India Cost India Cost, Genetic Infertility Treatment India Cost, Genetic India Cost, PGD India Cost, Genetic India Cost, Define DNA India Cost, Genetic Mistakes India Cost, Genetic Problems India Cost, Chromosomes India Cost, Chromosome Rearrangement India Cost, Sperm Cost, Egg Cost, Karyotyping Cost, FISH Cost, PGD Cost, Cost, Humans Genetics Cost, Genetics Disorders Cost, Genetics Health Information Cost, Genetic Disorders Cost, Genetics Counseling Cost, X Chromosome Cost, Y Chromosomes Cost, Genetic Tests Cost, Infertility Treatment For Genetic Disorders